Piltdown Hoax

1)      The Piltdown hoax began in the early 1900’s, when a piece of a skull was found by a man at a digging site and gave it to Charles Dawson. The skull piece was found in a digging site in Barkham near Piltdown. This would have been the first “early man” found in Britain, so this was a really big discovery. It also would have showed that humans developed a big brain before we learned to walk upright. The scientific community would go on believing this to be true for the next forty years. The hoax was revealed forty years later when a man named Kenneth Oakley performed a chemical test on the skull to authenticate and date the bone. The jaw piece was found to not be as old as they originally thought, and that it in fact wasn’t even human. The teeth were filed down to look human, and the bone had been boiled and dyed to look older. This was a huge upset to the scientific community, because many had based their entire careers off the findings from the Piltdown findings.

2)      As humans we all have faults, often times these faults involve greed or pride. In the case of the Piltdown Man, the scientists were blinded by their own ambition, pride, and greed. They wanted to take credit for finding the first early man in Great Britain, because the French and Germans already had fossil remains of early humans. They took pride in finding the first human to show that we as a species developed our big brains before we walked upright, which until this finding the opposite was believed. If the scientists would have been able to put their pride aside, they would have possibly been more likely to see the faults in the piece of bone.

3)      From the beginning, there were always people who were skeptical of the Piltdown Man and if it was real or not. As time went on, more and more people in other countries became skeptical about the authenticity of the fossil, which had been believed as real for the past forty years. The scientists began asking more questions regarding the fossilized jaw bone. In 1953, the jaw bone was chemically tested to reveal the origin of the bone and how old it really was. Turns out they got the answer to the forty year long hoax. The jaw bone was not human and it wasn’t as old as they had thought it to be.

4)      The only way the “human” factor could be removed from science is to replace all the humans with robots. If this were to happen, science would lose all the passion and creativity behind it. In order to make advances in science, there must be a human mind behind the creation of the idea because the human mind is capable of dreaming about things which seem to be impossible.

5)      From this it is easy to take away that in order to say you believe something to be true, you must actually investigate that idea or object yourself first. If you believe something because someone tells you it’s true, and you never investigate yourself, things like the Piltdown hoax will occur.

Analogy/Homology

a.      Human “Tailbone” and the chimpanzee ancestor tail

b.      The tailbone in humans has its name because it comes from the same homologous structure that gives other species its tail. In humans it is called “vestigial” because it is the last “vestige” or trait of what was once a tail in a common ancestor. In humans, the tailbone is no longer useful because we do not grow or need tails anymore, but we have a common ancestor with the chimpanzee who did need a tail. Mammals who have tails use them for balance, but as humans diverged genetically from our common chimpanzee ancestor millions of years ago, we learned to walk on two legs without using a tail for balance.

c.      Chimpanzees are the closest living ancestor of humans, but even the chimpanzee split from our common ancestor around 13 million years ago. Humans and chimpanzees share a common ancestor which is described as ape-like. When humans made the genetic divergence 13 million years ago, the tail was no longer needed and thus began to disappear.

d.       

2.       

a.      I chose the penguin and the fish fins for the analogous trait. Both species have fins on their bodies used to navigate through the water.

b.      Both species have fins which are used to navigate through the water. However, the fish fin is more specifically developed for water since it spends its entire life in the water. The penguin fin is more webbed because it need to balance as it walks on land as well as using it to propel it through the water. Fish also have a few different kinds of fins on their bodies for different purposes all related to swimming through the water.

c.      There are no common ancestors between the fish and the penguin. The fish is a sea animal and has sea animal ancestors, while the penguin has more primarily land ancestors.

d.      

DNA Strand

Who ever decodes this have fun :)

TAAGTACCACTAAGGATGGCACTGAATCGCAT

Historical Influences on Darwin

1. I feel that Charles Malthus was the person of the most positive influence on Charles Darwin and his work with his theory of Natural selection.

2.  Thomas Malthus wasn't a scientist in the way Charles Darwin was, but rather he was an economist who was fascinated with the growth and decline of a population. Malthus was focused on the idea that as a population increases in number, the food supply would be limited to only those who could gain access to it. With a higher population, there would be more struggle over food, more people would face starvation and disease, and therefore only the most fit would survive.

3. The idea Thomas Malthus had about the rise of a population equaling a rise in competition for food fits a few bullet points of how evolution works. The first is "Limited resources," every species has a limited amount of resources they can use for survival so as their population rises, the limitation on the amount of resources available rises as well. The second point is "Who gets access to the limited resources." The ones who will gain access to the limited resources available to a certain population, are the ones who are the most fit to survive: the strongest, fastest, more agile, more camouflaged, what ever trait they have that gives them a higher chance at survival will give them a higher chance at the resources.

4. Just like with all aspects of science and math, if one person didn't discover something at the time they did, someone else along the way would eventually have. With only actually physically observing different populations of animals, Darwin surely would have noticed a trend with the population increasing along with the struggle for their resources. He would have been able to conclude that when there are more and more of a species, they will have to fight to survive and only the ones most fit will win.

5. Charles Darwin knew he would get backlash from the Church and many people who had strong beliefs at the time. There would be many people who would be angry with his claims, and even discount them because what the Church taught everyone at the time was believed as the only thing that was right and everything else was wrong.

Link about Charles Malthus:
http://www.econlib.org/library/Enc/bios/Malthus.html

Stranded!

If I was stranded on a desert island two items I would want to have with me are my slackline and my camera. If you don't know what slacklining is, its similar to tightrope walking, except it a flat piece of webbing that you walk on instead of a rope or wire. The line can be set up between two poles, trees, or any kind of solid anchor in the ground. I would want my slackline there to keep me occupied and help pass time by doing something fun that I enjoy. I could also use my slackline as part of a survival tool since the webbing is extremely strong. The second item I would want to bring with me is my camera. I always joke that it is like my child, but it really is that important to me. I can capture moments that will last a lifetime, and express myself in a creative way. Photography is also easy, fun money for a starving college student. I would want my camera to be able to capture pictures of what ever landscape is on the island. It could also double as a light reflector by using the mirrors in the lens to signal for help.